Myokines in treatment-naïve patients with cancer-associated cachexia

Cancer-associated cachexia is a complex metabolic syndrome characterized by weight loss and systemic inflammation. Muscle fatty infiltration into muscle are associated with poor prognosis in cancer patients. Skeletal secretes myokines, factors autocrine, paracrine and/or endocrine action, which may be modified or play role cachexia. This study examined myokine content the plasma, skeletal tumor homogenates from treatment-naïve patients gastric colorectal stages I-IV (CC, N = 62), not (weight stable cancer, WSC, 32). Myostatin, interleukin (IL) 15, follistatin-like protein 1 (FSTL-1), acid binding 3 (FABP3), irisin brain-derived neurotrophic factor (BDNF) samples was measured Multiplex technology; body composition lipid were evaluated computed tomography, quantification of triacylglycerol (TAG) muscle. Cachectic presented lower FSTL-1 expression (p 0.047), higher FABP3 plasma 0.0301) tissue 0.0182), IL-15 0.007) 0.0110), compared to WSC. Neither TAG content, nor attenuation different between cachectic Lumbar adipose (AT) index, visceral AT index subcutaneous CC 0.0149, p 0.0455 0.0087, respectively), who also muscularity cohort (69.2% patients; 0.0301), The results indicate profile muscle, impacted These findings show that myokines eventually affecting wasting solely derive itself (as contribute scenario), put forward new perspectives on treatment targeting receptors pathways. Cachexia comorbidity ongoing without fat [[1]Evans W.J. Morley J.E. Argilés J. Bales C. Baracos V. Guttridge D. et al.Cachexia: definition.Clin Nutr. 2008; 27: 793-799https://doi.org/10.1016/j.clnu.2008.06.013Abstract Full Text PDF PubMed Scopus (1459) Google Scholar]. occurs around 80% advanced disease [[2]Bruera E. Sweeney asthenia patients.Lancet Oncol. 2000; https://doi.org/10.1016/S1470-2045(00)00033-4Abstract (66) markedly related during treatment, reduced quality life, decreased survival [[3]Prado C.M.M. V.E. McCargar L.J. Reiman T. Mourtzakis M. Tonkin K. al.Sarcopenia as determinant chemotherapy toxicity time progression metastatic breast receiving capecitabine treatment.Clin Cancer Res. 2009; https://doi.org/10.1158/1078-0432.CCR-08-2242Crossref (671) Scholar,[4]Martin L. Birdsell MacDonald N. Clandinin M.T. al.Cancer age obesity: depletion powerful prognostic factor, independent mass index.J Clin 2013; https://doi.org/10.1200/JCO.2012.45.2722Crossref (1257) Systemic inflammation hallmark hypothesized one driving forces inducing [[5]Argilés J.M. López-Soriano F.J. Catabolic proinflammatory cytokines.Curr Opin Nutr Metab Care. 1998; 1: 245-251https://doi.org/10.1097/00075197-199805000-00002Crossref (55) chronic inflammatory result combination tumor-secreted host's unbalanced immune/inflammatory response presence [[6]Muscaritoli Bossola Aversa Z. Bellantone R. Rossi Fanelli F. Prevention cachexia: insights an old problem.Eur J Cancer. 2006; 42: 31-41https://doi.org/10.1016/j.ejca.2005.07.026Abstract (194) Scholar,[7]de Matos-Neto E.M. Lima J.D.C.C. de Pereira W.O. Figuerêdo R.G. Riccardi DM. do Radloff al.Systemic - cytokine culprit?.Front Immunol. 2015; 6https://doi.org/10.3389/fimmu.2015.00629Crossref (46) corresponds approximately 40% total weight, this several act manner regulating physiology remote organs [[8]Lee J.H. Jun H.S. Role function.Front Physiol. 2019; https://doi.org/10.3389/fphys.2019.00042Crossref (90) muscle-derived known myokines. Among them, myostatin, member transforming growth ? (TGF-?) superfamily, postulated involved pathogenesis cancer-associated cachexia, owing its negative regulation mass, through type II activin receptors. Although studies animal models have shown myostatin implicated [9Costelli P. Muscaritoli Bonetto A. Penna Reffo al.Muscle signalling enhanced experimental cachexia.Eur Invest. https://doi.org/10.1111/j.1365-2362.2008.01970.xCrossref (138) Scholar, 10Liu C.M. Yang Liu C.W. Wang Tien Dale al.Myostatin antisense RNA-mediated normal mice.Gene Ther. https://doi.org/10.1038/sj.gt.3303016Crossref (80) 11Busquets S. Toledo Orpí Massa Porta Capdevila blockage using actRIIB antagonism mice bearing Lewis lung carcinoma improvement physical performance.J Sarcopenia Muscle. 2012; https://doi.org/10.1007/s13539-011-0049-zCrossref Scholar], clinical trial studying pancreatic failed any benefit antimyostatin antibody preserving improving patients’ overall [[12]Golan Geva Richards Madhusudan Lin B.K. H.T. al.LY2495655, antibody, cancer: randomized, phase 2 trial.J 2018; https://doi.org/10.1002/jcsm.12331Crossref (36) Moreover, has been reported low [[13]Loumaye De Barsy Nachit Lause Frateur Van Maanen al.Role A human cachexia.J Endocrinol Metab. https://doi.org/10.1210/jc.2014-4318Crossref (98) We chose investigate previously described modulated Interleukin 15 mass. rat model diminishing breakdown when administered subcutaneously [[14]Carbó Costelli Busquets Alvarez B. Baccino F.M. al.Interleukin-15 antagonizes waste tumour-bearing rats.Br https://doi.org/10.1054/bjoc.2000.1299Crossref (132) In mouse overexpression attenuated fatigue [[15]Bohlen McLaughlin S.L. Hazard-Jenkins H. Infante A.M. Montgomery Davis al.Dysregulation metabolic-associated pathways patients: preclinical evaluation interleukin-15 fatigue.J https://doi.org/10.1002/jcsm.12294Crossref (14) Furthermore, serum inversely correlated percentage [[16]Martínez-Hernández P.L. Hernanz-Macías Á. Gómez-Candela Grande-Aragón Feliu-Batlle Castro-Carpeño al.Serum levels cachexia.Oncol Rep. https://doi.org/10.3892/or.2012.1928Crossref (13) spite that, administration increases apoptosis rats [[17]Pistilli E.E. Alway S.E. elevation vivo promotes muscles young adult aged rats.Biochem Biophys Res Commun. https://doi.org/10.1016/j.bbrc.2008.05.188Crossref (29) Follistatin-like (FSTL-1) stimulates angiogenesis vascularization [[18]Ouchi Oshima Y. Ohashi Higuchi Ikegami Izumiya al.Follistatin-like 1, secreted protein, endothelial cell function revascularization ischemic nitric-oxide synthase-dependent mechanism.J Biol Chem. https://doi.org/10.1074/jbc.M803440200Abstract (208) gene found diminished [[19]Fontes-Oliveira C.C. Fuster G. Ametller Figueras Olivan al.A differential pattern tumor-bearing reveals dysregulation excitation-contraction coupling together additional alterations.Muscle Nerve. 2014; https://doi.org/10.1002/mus.23893Crossref (9) while little about form syndrome. Fatty (FABP3) cytoplasmic carrier facilitates transport lipophilic substances sarcolemma cellular compartments. It part secretome soleus gastrocnemius [[20]Roca-Rivada Al-Massadi O. Castelao Senín L.L. Alonso Seoane L.M. organ: comparative profiling slow-oxidative fast-glycolytic explants variation exercise.J Proteomics. https://doi.org/10.1016/j.jprot.2012.06.037Crossref (32) Physical exercise able increase circulating [[21]Hutchinson K.A. Mohammad Garneau McInnis Aguer Adamo K.B. Examination pregnant non-pregnant women following acute bout moderate-intensity walking.Front https://doi.org/10.3389/fphys.2019.01188Crossref (6) Scholar] mRNA [[22]Lammers Poelkens van Duijnhoven N.T.L. Pardoel Hoenderop J.G. Thijssen D.H.J. al.Expression genes insulin signaling altered inactivity training muscle.Am Physiol https://doi.org/10.1152/ajpendo.00356.2012Crossref (22) (or density) [[23]Shahda Narasimhan Kays Perkins S.M. Cheng Hannaford K.N. al.Identification biomarkers for cachexia.BioRxiv. : 359661https://doi.org/10.1101/359661Crossref (0) but direct correlation still missing. Other such studied context Irisin, newly discovered myokine, seems pro-myogenic mice, stimulating satellite cells activation decreasing degradation, inhibiting atrogin-1 RING-finger protein-1 [[24]Reza M.M. Subramaniyam Sim Ge X. Sathiakumar McFarlane al.Irisin induces hypertrophy rescues denervation-induced atrophy.Nat 2017; https://doi.org/10.1038/s41467-017-01131-0Crossref (84) Postmenopausal sarcopenia [[25]Park Kim H.C. Zhang Yeom Lim S.K. novel irisin: implications potential biomarker postmenopausal women.Endocrine. https://doi.org/10.1007/s12020-018-1814-yCrossref (23) [[26]Zhu Pan Li ATF3 FNDC5/irisin obesity.Front https://doi.org/10.3389/fphys.2018.01125Crossref [[27]Provatopoulou Georgiou G.P. Kalogera Kalles Matiatou M.A. Papapanagiotou I. association diagnosis characteristics.BMC https://doi.org/10.1186/s12885-015-1898-1Crossref (59) irisin. neurotrophin BDNF ubiquitously expressed nervous system, where it participates neurons synaptogenesis abundant number can express both satellites cells, being thus regeneration Scholar,[28]Clow Jasmin B.J. Brain-derived regulates differentiation skeltal regeneration.Mol Cell. 2010; https://doi.org/10.1091/mbc.E10-02-0154Crossref Finally, [[29]Ferris L.T. Williams J.S. Shen C.L. effect cognitive function.Med Sci Sports Exerc. 2007; https://doi.org/10.1249/mss.0b013e31802f04c7Crossref (558) Scholar,[30]Máderová Krumpolec Slobodová Schön Tirpáková Kovani?ová al.Acute regular distinctly modulate serum, elderly.Neuropeptides. https://doi.org/10.1016/j.npep.2019.101961Crossref Considering important roles peripheral organs/tissues, well central system our aim measure FSTL-1, IL-15, FABP3, irisin, examine possible among parameters factors. Therefore, carried out along tomography (CT) image analysis establish patterns. we myosteatosis, CTs proteins storage uptake, measuring samples. All procedures adopted approved Ethics Committee Research Involving Human Subjects Institute Biomedical Sciences (CAAE nº 00475118.7.0000.5467 5493116.6.0000467), University Alberta Office (Pro00056656); performed principles Declaration Helsinki. Patients sexes (ages 30–90 years) recruited at Hospital São Paulo, Santa Casa Misericordia Hospital, Instituto Arnaldo Vieira Carvalho (São SP), after providing fully informed consent. Biopsies rectus abdominis collected surgery. Height obtained hospital staff (using platform scales height rod, wearing gown no shoes). Blood collection, change obtainment questionnaire answers occurred 18 h–2 h immediately before Exclusion criteria were: continuous use anti-inflammatory past six months, antibiotics previous month, engagement radiotherapy 5 years, acquired immunodeficiency syndrome, auto-immune disorders, liver kidney failure, (BMI) > 29.9 kg/m2, uncontrolled diabetes mellitus other aetiologies apart Identification followed proposed Evans al. (2008) Anorexia symptoms life scores validated questionnaires – Functional Assessment Anorexia/Cachexia Therapy Subscale/European Society Clinical Nutrition Metabolism (FAACT-ESPEN) [[31]Arezzo di Trifiletti Misino Giannantoni Cascino Fazi al.Comparison performance four tools diagnosing disease-associated anorexia their relationship nutritional, functional outcome measures hospitalized patients.Clin 2013 Aug; 32: 527-532https://doi.org/10.1016/j.clnu.2012.11.011Abstract European Organization Treatment (EORTC QLQ-STO22) [[32]Aaronson N.K. Ahmedzai Bergman Bullinger Cull Duez N.J. al.The organization research QLQ-C30: quality-of-life instrument international trials oncology.J Natl Inst. 1993; 85: 365-376https://doi.org/10.1093/jnci/85.5.365Crossref (9826) (CC group) 5% last months BMI < 20 kg/m2; alterations increased C-reactive (CRP), albumin blood hemoglobin; self-reported symptoms, anorexia, impaired ability. did meet these assigned group (WSC). Computed scans, prior abdominal surgery tumour resection participating hospitals, retrieved secondary purpose composition; images requested study. CT scans analysed Unit (University Alberta, Canada) trained researcher blinded Patient's group. single axial third lumbar vertebra selected assessment, SliceOmatic (v.5.0, Tomovision, Montreal, Canada). segmented tissue-specific Hounsfield Units (HU; ?29 +150 ?190 ?30 intermuscular AT, ?150 ?50 AT) [[33]Miller K.D. Jones Yanovski J.A. Shankar Feuerstein Falloon Visceral abdominal-fat accumulation indinavir.Lancet. https://doi.org/10.1016/S0140-6736(97)11518-5Abstract (600) manually corrected necessary. cross-sectional area (square centimetres cm2) calculated automatically sum pixels multiplied pixel surface [[34]Mourtzakis Prado Lieffers J.R. practical precise approach routine care.Appl Metabol. 33: 997-1006https://doi.org/10.1139/H08-075Crossref (1104) adiposity manner, subcutaneous, visceral, (all cm2). based normalized square (m2). Low classified stated ESPEN guidelines nutrition [[35]Arends Bachmann Barthelemy Bertz Bozzetti al.ESPEN 2017 Feb; 36: 11-48https://doi.org/10.1016/j.clnu.2016.07.015Abstract (1123) (men 55 cm2/m2 woman 39 cm2/m2). radiodensity explored mean HU; reflective “quality” Prior resection, tubes separation. Tubes centrifuged 3000 rpm min 4 °C placed microtubes stored ?80 further analysis. Available commercial kits used obtain concentration CRP (ultrasensitive Turbiquest plus, cat. 331, Labtest, Lagoa Santa, MG, Brazil), (cat. 19, cholesterol 76, LDL 129, Labtest HDL 98, Brazil) Nº 87, automatic analyser (LABMAX 240® equipment, Brazil). Serum IL-6, IL-8, necrosis (TNF) ?, technology Magpix (Life Technologies, Grand Island, NY, USA) (HCYTMAG-60 K-PX29 TNF? HMYOMAG-56 K Merck-Millipore, St. Charles, MO, USA). detected samples, serum. intra inter-assay coefficient (CV) 2.9% 6.7%; 1.1% 1.6%; 1.3% 2.2%; 0.8% 1.5%; 0.7% 1.2%; 1.8%; IL-6 2.0% 18.3%; IL-8 1.9% 3.5%; 2.6% 13%; 2.7% 8.1% respectively, manufacture. Plasma CV <10% <15%, manufacturer. resection. Protein extraction 50 mg frozen radioimmunoprecipitation assay (RIPA) buffer (10 mM Tris base, 0.01 EDTA, 0.1 Sodium Chloride 1% Triton X-100), proteinase phosphatase inhibitors (Roche, Mannheim, Germany), Polytron, ice. homogenate 14,000×g, 30 min, °C, liquid upper transferred tube. centrifugation procedure repeated, second quantify employing Bradford (Bio-rad Laboratories; Hercules, CA, USA), standard curve bovine albumin. Myokine kit (HMYOMAG-56 K, BDNF, declared Total RNA extracted TRIzol® reagent (Trizol reagent—Invitrogen, Life Carlsbad, verified agarose gels quantified spectrophotometer (Fisher Scientific, Biotek, Winooski, cDNA synthesis reverse transcription (High Capacity Reverse Transcription Kit, Technologies). Sybr green master mix (Fast SYBR® Green Master Mix, Thermo Fisher Vilnius, Lithuania) specific primers each (Invitrogen, perform real qPCR QuantStudio 12 Flex Real-Time PCR System (Applied Biosystems, Relative against housekeeping gyceraldehyde-3-phosphate dehydrogenase (GAPDH) 2-??CT method. Sense (forward—F) (reverse—R) sequences CD36 F GATTAATGGTACAGATGCAGCCT, R GGAAGAACAAATCTATACACAGGG; Perilipin GGTGTTTGATTTCACCACCA, ATTCAACATCTTGCCCTGAG; CTTCCCTTTCTCCAGCAACC; CCAGTACAACATCCACAGCA; GAPDH CCTCTGACTTCAACAGCGAC, CGTTGTCATACCAGGAAATGAG. biopsies method Folch [[36]Folch Lees Stanley G.H.S. ARTICLE: simple isolation purification lipides tissues.J 1957; 226: 497-509https://doi.org/10.1007/s10858-011-9570-9Crossref (33) After extraction, chloroform solution clean glass tube dried under nitrogen flow. Lipids resuspended isopropanol manufacturer's instructions 1.8%, data tested normality homoscedasticity D'Agostino & Pearson omnibus test, Shapiro–Wilk test Kolmogorov–Smirnov test. Parametric unpaired Student T-test represented ± error mean. Non-parametric Mann–Whitney median [interquartile range]. Chi-square employed compare dichotomized parameters. Statistical GraphPad Prism 6 GNU (version 4.0). Level significance set value 0.05 (two-tailed). G?Power software [[37]Faul Erdfelder Lang A.G. Buchner ?Power 3: flexible statistical power program social, behavioral, biomedical sciences.Behav Methods. https://doi.org/10.3758/BF03193146Crossref (24041) calculate size post-hoc variables mean, deviation sample variable Results Supplemental Table 1. logistic regression perf